Home Forums User CP Gallery New Posts  
Translate:
Arabic Bulgarian Chinese Czech English French German Indonesian Italian Japanese Korean Portuguese Russian Spanish

Homebox Growtent

treating yourself

aqualab

StonesCafe

Canna Campo

Reply
Old 02-09-2010, 07:25 AM   #1 (permalink)
Junior Farmer
 
Join Date: Feb 2010
Location: Where the sun meets the moon
Posts: 26
nucleotide is on a distinguished road
nucleotide's Gallery
Default reppin' the mitten
Hey kids,

Rockin' out here in MI.
Enjoying the new laws.
__________________
GGGGACACACACACACAACACAACCCCCTAGAGAGAGAGATTCTTCTTCT TCTACAGATACAGCGAAGAAGCAAACGCATACCTCGTGAGAGCCTAAAAC TCATTTCCCTCTATTCTTTCTCTCTCTCTCTCTCTCTCTCCCTCTCTCCT ATTTGGGTTATTAAAATC
nucleotide is offline   Reply With Quote
Old 02-09-2010, 02:25 PM   #2 (permalink)
Super Moderator
 
sunsimulator's Avatar
 
Join Date: Dec 2008
Location: In My House
Posts: 332
sunsimulator will become famous soon enough
sunsimulator's Gallery
Default
Originally Posted by nucleotide View Post
Hey kids,

Rockin' out here in MI.
Enjoying the new laws.

love the name and the sequence code! 4 types !!
__________________
Spending more time trying to improve myself ,, Leaves me less time to prove myself!
sunsimulator is offline   Reply With Quote
Old 02-09-2010, 02:27 PM   #3 (permalink)
Senior Farmer
 
Skunkmasterflex's Avatar
 
Join Date: Jun 2009
Location: mitten
Posts: 758
Skunkmasterflex will become famous soon enough
Skunkmasterflex's Gallery
Default
welcome bro~ mitten represent!
__________________
Owner/Founder of Funky Skunk Organics
...Reppin the dirty mitten through and though!!....
Skunkmasterflex is online now   Reply With Quote
Old 02-09-2010, 05:15 PM   #4 (permalink)
Junior Farmer
 
Join Date: Feb 2010
Location: Spartans
Posts: 12
medicinemen is on a distinguished road
medicinemen's Gallery
Default
mitten represent. Im new here too..much love.
medicinemen is offline   Reply With Quote
Old 02-09-2010, 05:58 PM   #5 (permalink)
Senior Farmer
 
Pot Boy's Avatar
 
Join Date: Jan 2010
Location: In a tube amp..
Posts: 130
Pot Boy is on a distinguished road
Pot Boy's Gallery
Default
Lot O peeps from the mitten here.. WELCOME!
__________________
Over grow the haters!
Pot Boy is offline   Reply With Quote
Old 02-09-2010, 06:33 PM   #6 (permalink)
Junior Farmer
 
Join Date: Feb 2010
Location: Trinity
Posts: 29
trinityalps is on a distinguished road
trinityalps's Gallery
Default
Nucleotide! Welcome
And from MI to boot... which penninsula? Grew up there, did biochem at MSU back in the 70s, so you already have a good resonance with me. Been living in CA ever since. Gotta love that med law--my 80-something parents even voted for it. Is it being challenged by the dutch reformers yet?

--Trinity Alps
trinityalps is offline   Reply With Quote
Old 02-09-2010, 08:11 PM   #7 (permalink)
Senior Farmer
 
4u2sm0ke's Avatar
 
Join Date: Dec 2009
Location: Seattle
Posts: 471
4u2sm0ke is on a distinguished road
4u2sm0ke's Gallery
Default




Welcome to the Farm
4u2sm0ke is offline   Reply With Quote
Old 02-10-2010, 10:49 PM   #8 (permalink)
Farmer
 
Whippleschnitz's Avatar
 
Join Date: Dec 2008
Location: Zone 6
Posts: 93
Whippleschnitz is on a distinguished road
Whippleschnitz's Gallery
Default
Welcome to the farm.
__________________
M.U.R.D.A Jillybean, SAGEnSour, HappyBrotherxChemD IX1 F2, PurplerKushxChem 08
Whippleschnitz is offline   Reply With Quote
Old 02-12-2010, 09:13 AM   #9 (permalink)
Junior Farmer
 
Join Date: Feb 2010
Location: Where the sun meets the moon
Posts: 26
nucleotide is on a distinguished road
nucleotide's Gallery
Default
I'm from the lower peninsula.
Livin' in West MI these days.
I've lived all over MI though.

Trinity, I'm a Spartan as well.
Whats up with our basketball team? 3 losses in a row...

Haha, the Dutch reformers.
Their haven in the West of MI is being encroached upon slowly.
They can't be ultra conservative forever, especially with our crap economy!
__________________
GGGGACACACACACACAACACAACCCCCTAGAGAGAGAGATTCTTCTTCT TCTACAGATACAGCGAAGAAGCAAACGCATACCTCGTGAGAGCCTAAAAC TCATTTCCCTCTATTCTTTCTCTCTCTCTCTCTCTCTCTCCCTCTCTCCT ATTTGGGTTATTAAAATC
nucleotide is offline   Reply With Quote
Reply

« Howdy Farmers :) | Hash made easy »
Thread Tools Search this Thread
Search this Thread:

Advanced Search
Display Modes
Linear Mode Linear Mode

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts
BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On
Forum Jump

Powered by vBadvanced CMPS v3.1.0
All times are GMT. The time now is 04:16 AM.